View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_25 (Length: 291)
Name: NF21430_low_25
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 79 - 218
Target Start/End: Original strand, 26377128 - 26377267
Alignment:
| Q |
79 |
gaccttggaagcattgagtttgacccgtgtccaacgagacgcagcagtttcaggcaaattaaagaacgaaattgtgctatgattcaacctaacaaaatct |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26377128 |
gaccttggaagcgttgagtttgacccgtgtccaacgagacgcagcagtttcaggcaaattaaagaacgaaattgtgctatgattcaacctaacaaaatct |
26377227 |
T |
|
| Q |
179 |
atcgcttgccacctgaacaacaattcaacatttatttctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26377228 |
atcgcttgccacctgaacaacaattcaacatttatttctc |
26377267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University