View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_29 (Length: 286)
Name: NF21430_low_29
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 43016576 - 43016495
Alignment:
| Q |
21 |
aatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaattgtcatcaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016576 |
aatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaattgtcatcaa |
43016495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 164 - 199
Target Start/End: Complemental strand, 43016433 - 43016398
Alignment:
| Q |
164 |
aggcctacttatatggaaagctgcgtttgcactaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016433 |
aggcctacttatatggaaagctgcgtttgcactaat |
43016398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University