View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_33 (Length: 243)
Name: NF21430_low_33
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 46356140 - 46356351
Alignment:
| Q |
20 |
caaagtctatattccctccctttcnnnnnnnattttaagcaaatactattagaaagaatatgataccctctttcttatactttttctcatagatatggtt |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356140 |
caaagtctatattccctccctttctttttt-attttaagcaaatactattagaaagaatatgataccctctttcttatactttttctcatagatatggtt |
46356238 |
T |
 |
| Q |
120 |
aaaaaagagtcttctaattcactgattgagattcgagcttttcaggataatggggtaccattcacacccactgatatcgttatatagtactataatttac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46356239 |
aaaaaagagtcttctaattcactgattgagattcgagcttttcagggtaatggggtaccattcacacccactgatatcgttatatagtactataatttac |
46356338 |
T |
 |
| Q |
220 |
acctttgcttctc |
232 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
46356339 |
acctttgtttctc |
46356351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University