View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_37 (Length: 218)
Name: NF21430_low_37
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 32 - 177
Target Start/End: Complemental strand, 38314322 - 38314177
Alignment:
| Q |
32 |
tgagaatggtaccctctacgatcatttaatgagtcatattttttaggaacataaaattcatttgccatggtaaatatgttgaaggtgatagttcaatggt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38314322 |
tgagaatggtaccctctacgatcatttaatgagtcatattttttaggaacataaaattcatttgccatggtaaatatgttgaaggtgatagttcaatggt |
38314223 |
T |
 |
| Q |
132 |
ttatatattaacattgaataatttccttgagattatacatgacaaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38314222 |
ttatatattaacattgaataatttccttgagattatacatgacaaa |
38314177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University