View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21431_low_4 (Length: 226)
Name: NF21431_low_4
Description: NF21431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21431_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 54 - 210
Target Start/End: Complemental strand, 2468178 - 2468022
Alignment:
| Q |
54 |
agcagaacctgtgcttaagtcaccgacatctccaaatataggaattgaattcaaaccagtagcaaaatcagaagcagcaactgccggaaaagcatcttga |
153 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468178 |
agcaaaacctgtgcttaagtcaccgacatctccaaatataggaattgaattcaaaccagtagcaaaatcagaagcagcaactgccggaaaagcatcttga |
2468079 |
T |
|
| Q |
154 |
agtgcgaagaacgcagagaacagcataaacttcaaaactgtcatggatgcatcatca |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468078 |
agtgcgaagaacgcggagaacagcataaacttcaaaactgtcatggatgcatcatca |
2468022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University