View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21433_low_14 (Length: 312)
Name: NF21433_low_14
Description: NF21433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21433_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 121 - 301
Target Start/End: Original strand, 2291584 - 2291765
Alignment:
| Q |
121 |
ggctgttctgttgcaaattgaattagtttttgttagtatgttattcttctttgtactttgata-ctattttacgtaaatgttgtttctattgatcaataa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| | |
|
|
| T |
2291584 |
ggctgttctgttgcaaattgaattagtttttgttagtatgttattcttctttgtactttgataactattttacgtaaatgttatttctattgatcaatga |
2291683 |
T |
 |
| Q |
220 |
cttcttttaactatgttcatattgtgcagttgaagttgattggtatgcaattgttggtggcgatgagaggcagttggatatt |
301 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2291684 |
cttcttttaactatgttcatgttgtgcagttgaagttgattggtatgcaattgttggtggcgatgagaggcagttggatatt |
2291765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 2291488 - 2291519
Alignment:
| Q |
18 |
atgctattcacctacttactgattggttggtg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2291488 |
atgctattcacctacttactgattggttggtg |
2291519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University