View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21434_high_21 (Length: 229)
Name: NF21434_high_21
Description: NF21434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21434_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 44112519 - 44112717
Alignment:
| Q |
20 |
atgaggacgttacctctagcttgctggtatgctttgattcattttacgtgttataagagtaagacttggtgtaaataactaatcatatttaactaatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44112519 |
atgaggacgttacctctagcttgctggtatgctttgattcattttacgtgttataagagtaagacttggtgtaaataactaatcatatttaactaatcaa |
44112618 |
T |
 |
| Q |
120 |
atgttttgtaatgttgaaaacattaacgaattgtgtttgttaacttttgcctatgaacaaatgaccnnnnnnnnngtattgagacatcaattagtttta |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44112619 |
atgttctgtaatgttgaaaacattaacgaattgtgtttgttaacttttgcctatgaacaaatgaactttttttttgtattgagacatcaattagtttta |
44112717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University