View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21434_low_13 (Length: 267)
Name: NF21434_low_13
Description: NF21434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21434_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 32844250 - 32844015
Alignment:
| Q |
17 |
agttcccgccacttctctctcttccaaactactcaccctgctctccttcctcactctcaaccccttcgccaaactcaccgcggatgatttctccgccgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
32844250 |
agttcccgccacttctctctcttccaaactcctcaccctcctctccttcctcactctcaaccccttcgccaaactcaccgccgatgatttctccgcagat |
32844151 |
T |
|
| Q |
117 |
actccttcttggtcacgctccttcgttggttcatctgattcctactctttcccctcttctccttctcaagctcgctttcgtgtacatgaaaatgttaagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32844150 |
actccttcttggtcacgctccttcgttggttcatctgattcctactcttttccttcttctccttctcaagctcgctttcgtgttcatgaaaatgttaagc |
32844051 |
T |
|
| Q |
217 |
gctatgctcggaattacgcctatctctttattgttt |
252 |
Q |
| |
|
| |||||||||||||| | |||||||||||||||| |
|
|
| T |
32844050 |
gttatgctcggaattattcttatctctttattgttt |
32844015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University