View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21434_low_18 (Length: 246)
Name: NF21434_low_18
Description: NF21434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21434_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 42845781 - 42845995
Alignment:
| Q |
13 |
aagaatatacatgcacaagcagctaaggcagggaagagagaaaagacagaaatgacaatggattttttgtactgggaggctatgagccgtgcaaacgtca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845781 |
aagaatatacatgcacaagcagctaaggcagggaagagagaaaagacagaaatgacaatggattttttgtactgggaggctatgagccgtgcaaacgtca |
42845880 |
T |
 |
| Q |
113 |
atgaaattgctgagcactcaaagaaagaggcatggataacatgcttgcagaacttattcagagtttcctacctgaatctactcgttgatgcacacagggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845881 |
atgaaattgctgagcactcaaagaaagaggcatggataacatgcttgcagaacttattcagagtttcctacctgaatctactcgttgatgcacacagggc |
42845980 |
T |
 |
| Q |
213 |
tactgatcttgtgtg |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42845981 |
tactgatcttgtgtg |
42845995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 33 - 165
Target Start/End: Original strand, 41979923 - 41980056
Alignment:
| Q |
33 |
agctaaggcagggaagagagaaaagacagaaatgacaatggattttttgtactgggaggctatgagccgtgcaaacgtcaatgaaattgctga-gcactc |
131 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| | ||||| | ||| ||||||| ||| |||| || ||||||||||| ||||||||||| ||| || |
|
|
| T |
41979923 |
agctacggctgggaagagagaaaagacagaaagcaacatggactcattggactgggaagctgtgagacgggcaaacgtcaaggaaattgctgatgcaatc |
41980022 |
T |
 |
| Q |
132 |
aaagaaagaggcatggataacatgcttgcagaac |
165 |
Q |
| |
|
||||| || |||||| | ||||||||||| |||| |
|
|
| T |
41980023 |
aaagagaggggcatgaacaacatgcttgctgaac |
41980056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University