View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21434_low_2 (Length: 596)

Name: NF21434_low_2
Description: NF21434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21434_low_2
NF21434_low_2
[»] scaffold0197 (2 HSPs)
scaffold0197 (1-543)||(30353-30900)
scaffold0197 (541-588)||(28316-28363)
[»] chr7 (4 HSPs)
chr7 (1-391)||(21317073-21317462)
chr7 (421-588)||(21316816-21316983)
chr7 (460-588)||(21314031-21314159)
chr7 (6-143)||(3930206-3930343)
[»] chr2 (1 HSPs)
chr2 (3-147)||(13576090-13576234)
[»] chr8 (5 HSPs)
chr8 (6-144)||(43479919-43480057)
chr8 (24-142)||(38799242-38799360)
chr8 (24-142)||(38822157-38822275)
chr8 (3-143)||(26591914-26592054)
chr8 (3-143)||(25865446-25865586)
[»] chr5 (4 HSPs)
chr5 (3-141)||(9866900-9867038)
chr5 (6-142)||(12531239-12531375)
chr5 (6-142)||(12547244-12547380)
chr5 (22-151)||(9894390-9894516)
[»] chr4 (2 HSPs)
chr4 (3-143)||(24860292-24860432)
chr4 (3-143)||(34748501-34748641)


Alignment Details
Target: scaffold0197 (Bit Score: 409; Significance: 0; HSPs: 2)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 1 - 543
Target Start/End: Complemental strand, 30900 - 30353
Alignment:
1 ccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
30900 ccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttt 30801  T
101 tccgccggtggatttgcgtgctgtttgtttggtacgtgccattttgattgaaaagaaattgaagagaaagaaaatattttgagatgttattgggatgatg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
30800 tccgccggtggatttgcgtgctgtttgtttggtacgtgccattttgattgaaaagaaattgaagagaaagaaaata-tttgagatgttattgggatgatg 30702  T
201 gatggtggaagaagtgttttgggtgttttatagggcggagaagattgaagnnnnnnntgcgggaattgggaaaatttgagaaggtgaaagggggagatgg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||    
30701 gatggtggaagaagtgttttgggtgttttatagggcggagaagattgaagaaaaaaatgcgggaattgggaaaatttgagaaggtgaaagggggagatgg 30602  T
301 tgaccgttgatgggaatagttatcaacggttgtgcgtctttgcaggaagggtgataggatcgggatccgtggcatgtgaaaccaaccaataaggtatctc 400  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30601 tgaccgttgatggaaatagttatcaacggttgtgcgtctttgcaggaagggtgataggatcgggatccgtggcatgtgaaaccaaccaataaggtatctc 30502  T
401 taa-nnnnnnnnnnnnnnnnnatagatatctcggaattgcattacgacatttgcatatgattcttttcaataagactcaagcgcaatatcg-----taaa 494  Q
    |||                  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |     |||     
30501 taattttttttttttttttttatagatatctcggaattgcattacgacatttgcatatgattcttttcaataagactcaagcgcaatatggggtgataag 30402  T
495 ctttcatgatactgttaactacttcacttgtcctcacctcattcattta 543  Q
      |  ||||||||||||||||||||||||||||||||||||||||||||    
30401 aatgaatgatactgttaactacttcacttgtcctcacctcattcattta 30353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 541 - 588
Target Start/End: Complemental strand, 28363 - 28316
Alignment:
541 ttacttatcttttccattcactttgacatccctaggtttgtctctgct 588  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
28363 ttacttatcttttccattcactttgacatccctaggtttgtctctgct 28316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 338; Significance: 0; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Complemental strand, 21317462 - 21317073
Alignment:
1 ccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
21317462 ccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttt 21317363  T
101 tccgccggtggatttgcgtgctgtttgtttggtacgtgccattttgattgaaaagaaattgaagagaaagaaaatattttgagatgttattgggatgatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||| |||||||||||||||||||||||    
21317362 tccgccggtggatttgcgtgctgtttgtttggtacgtgccattttgattgaaaagaaaactgagagaaagaaaata-tttgagatgttattgggatgatg 21317264  T
201 gatggtggaagaagtgttttgggtgttttatagggcggagaagattgaagnnnnnnntgcgggaattgggaaaatttgagaaggtgaaagggggagatgg 300  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||    
21317263 gatgttggaagaagtgttttgggtgttttatagggcggagaagattgaagaaaaaaatgcgggaattgggaaaatttgagaaggtgaaagggggagatgg 21317164  T
301 tgaccgttgatgggaatagttatcaacggttgtgcgtctttgcaggaagggtgataggatcgggatccgtggcatgtgaaaccaaccaata 391  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21317163 tgaccgttgatgggaatagttatcaacggttgtgcgtctttgcaggaagggtgataggatcgggatccgtggcatgtgaaaccaaccaata 21317073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 148; E-Value: 8e-78
Query Start/End: Original strand, 421 - 588
Target Start/End: Complemental strand, 21316983 - 21316816
Alignment:
421 atagatatctcggaattgcattacgacatttgcatatgattcttttcaataagactcaagcgcaatatcgtaaactttcatgatactgttaactacttca 520  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||    
21316983 atagatatctcggaattgcattacgacatttgtatatgattcttttcaataagactcgagcgcaatatcataaactttcatgatactgttaactaattca 21316884  T
521 cttgtcctcacctcattcatttacttatcttttccattcactttgacatccctaggtttgtctctgct 588  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
21316883 cttgtcctcacctcattcatttacttatctgttccattcactttgacatccctaggtttgtctctgct 21316816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 460 - 588
Target Start/End: Complemental strand, 21314159 - 21314031
Alignment:
460 ttcttttcaataagactcaagcgcaatatcgtaaactttcatgatactgttaactacttcacttgtcctcacctcattcatttacttatcttttccattc 559  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21314159 ttcttttcaataagactcaagcgcaatatcataaactttcatgatactgttaactacttcacttgtcctcacctcattcatttacttatcttttccattc 21314060  T
560 actttgacatccctaggtttgtctctgct 588  Q
    |||||||||||||||||||||||||||||    
21314059 actttgacatccctaggtttgtctctgct 21314031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 6 - 143
Target Start/End: Original strand, 3930206 - 3930343
Alignment:
6 gttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgc 105  Q
    ||||| |||||||| | |||||| ||||| || || ||||| ||||| |||||||| | ||||||||| |||||||||||||| |||||||||||||| |    
3930206 gttcctggacggaatctgtgtggtttctttacaccaccggttgccggtgctgattttcttgcggctttggtggcgagttgtttccgtggggcttttcctc 3930305  T
106 cggtggatttgcgtgctgtttgtttggtacgtgccatt 143  Q
    |||||||||| |||||||||||||||||||||||||||    
3930306 cggtggattttcgtgctgtttgtttggtacgtgccatt 3930343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 113; Significance: 6e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 3 - 147
Target Start/End: Complemental strand, 13576234 - 13576090
Alignment:
3 acggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttc 102  Q
    |||||||| ||||||||||| ||||||||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||||||||||| |||||||    
13576234 acggttccaggacggaaacgatgtggcttcttcactcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtttgcgtggtgcttttc 13576135  T
103 cgccggtggatttgcgtgctgtttgtttggtacgtgccattttga 147  Q
    |||||||||||||||| ||||||||||||||||||||||||||||    
13576134 cgccggtggatttgcgggctgtttgtttggtacgtgccattttga 13576090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 83; Significance: 5e-39; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 6 - 144
Target Start/End: Original strand, 43479919 - 43480057
Alignment:
6 gttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgc 105  Q
    ||||| |||||||| | |||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||| | ||| ||||| || |    
43479919 gttccaggacggaatctgtgtggcttcttcactcctccggtggccggagctgatttccgagcggctttggtggcgagttgtttccttggagctttgccac 43480018  T
106 cggtggatttgcgtgctgtttgtttggtacgtgccattt 144  Q
    ||||||||||||| || |||||||||||||| |||||||    
43480019 cggtggatttgcgagcggtttgtttggtacgagccattt 43480057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 24 - 142
Target Start/End: Complemental strand, 38799360 - 38799242
Alignment:
24 tgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctg 123  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| || || || || || || ||||||||||||||||| ||||    
38799360 tgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctg 38799261  T
124 tttgtttggtacgtgccat 142  Q
    |||| ||||||||||||||    
38799260 tttgcttggtacgtgccat 38799242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 24 - 142
Target Start/End: Original strand, 38822157 - 38822275
Alignment:
24 tgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctg 123  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| || || || || || || ||||||||||||||||| ||||    
38822157 tgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctg 38822256  T
124 tttgtttggtacgtgccat 142  Q
    |||| ||||||||||||||    
38822257 tttgcttggtacgtgccat 38822275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 3 - 143
Target Start/End: Complemental strand, 26592054 - 26591914
Alignment:
3 acggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttc 102  Q
    |||||||| || | |||||||||||||||||||||||| |||||||||||||| |||||||| |||||||| || ||||| || || | ||| ||||| |    
26592054 acggttcctggcctgaaacggtgtggcttcttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttggtgctttgc 26591955  T
103 cgccggtggatttgcgtgctgtttgtttggtacgtgccatt 143  Q
    |||||||||| |||||||| ||||| || ||||||||||||    
26591954 cgccggtggacttgcgtgcagtttgcttagtacgtgccatt 26591914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 3 - 143
Target Start/End: Complemental strand, 25865586 - 25865446
Alignment:
3 acggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttc 102  Q
    |||||||| |||||  |||| || |||||||||||||| ||||| |  ||||| ||||||| ||| ||||| || |||||||| || | ||| || || |    
25865586 acggttccaggacgataacgatgaggcttcttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttccttggtgccttgc 25865487  T
103 cgccggtggatttgcgtgctgtttgtttggtacgtgccatt 143  Q
    |||||||||||||||| || ||||| || ||||| ||||||    
25865486 cgccggtggatttgcgagcagtttgcttcgtacgagccatt 25865446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 71; Significance: 7e-32; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 3 - 141
Target Start/End: Original strand, 9866900 - 9867038
Alignment:
3 acggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttc 102  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||| || ||||| ||||| || |  || | ||| ||||| |    
9866900 acggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggccagcttctttcatggtgctttac 9866999  T
103 cgccggtggatttgcgtgctgtttgtttggtacgtgcca 141  Q
    |||||||||||||||| || ||||||||||||| |||||    
9867000 cgccggtggatttgcgagccgtttgtttggtacatgcca 9867038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 6 - 142
Target Start/End: Complemental strand, 12531375 - 12531239
Alignment:
6 gttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgc 105  Q
    ||||| |||||||| | |||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || || || | ||| ||||||||||    
12531375 gttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgc 12531276  T
106 cggtggatttgcgtgctgtttgtttggtacgtgccat 142  Q
    ||||||||||||| |||||||| |||||||| |||||    
12531275 cggtggatttgcgagctgtttgcttggtacgagccat 12531239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 6 - 142
Target Start/End: Original strand, 12547244 - 12547380
Alignment:
6 gttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgc 105  Q
    ||||| |||||||| | |||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || || || | ||| ||||||||||    
12547244 gttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttccgc 12547343  T
106 cggtggatttgcgtgctgtttgtttggtacgtgccat 142  Q
    ||||||||||||| |||||||| |||||||| |||||    
12547344 cggtggatttgcgagctgtttgcttggtacgagccat 12547380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 22 - 151
Target Start/End: Complemental strand, 9894516 - 9894390
Alignment:
22 ggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgc 121  Q
    |||||||||||||||||  |||||  ||| |||||||||| || |||||||| ||||| || || || ||||| ||||| ||||| ||    ||||||||    
9894516 ggtgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgc 9894420  T
122 tgtttgtttggtacgtgccattttgattga 151  Q
    |||||| ||||||| ||||||  |||||||    
9894419 tgtttgcttggtacctgccatggtgattga 9894390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 7e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 3 - 143
Target Start/End: Complemental strand, 24860432 - 24860292
Alignment:
3 acggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttc 102  Q
    ||||||||||||||||||||||| || ||||||||||| ||||| || ||||| |||||||| |||||||| || || || || || | ||| |||||||    
24860432 acggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttc 24860333  T
103 cgccggtggatttgcgtgctgtttgtttggtacgtgccatt 143  Q
    | |||||||||||||| |||||||| || ||||| ||||||    
24860332 ctccggtggatttgcgagctgtttgctttgtacgagccatt 24860292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 3 - 143
Target Start/End: Complemental strand, 34748641 - 34748501
Alignment:
3 acggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttagtggcgagttgtttgcgtggggcttttc 102  Q
    |||||||| || | ||||||||| || ||||||||||| ||||| |||||||| ||||| || |||||||| ||||| ||||| || | ||| ||||| |    
34748641 acggttcctggtctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttac 34748542  T
103 cgccggtggatttgcgtgctgtttgtttggtacgtgccatt 143  Q
    | || ||||||||||| || ||||| |||||||||||||||    
34748541 ctccagtggatttgcgagcggtttgcttggtacgtgccatt 34748501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University