View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_high_15 (Length: 330)
Name: NF21435_high_15
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_high_15 |
 |  |
|
| [»] scaffold0042 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 52800345 - 52800484
Alignment:
| Q |
1 |
gtgcgtgtcagatctagaaatgcttcagcgtcagcaacctgttctcgaggtttcttcacttgctcgtgtaacttatcgaactcatgaaggattgaatcga |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
52800345 |
gtgcgtgtcagatctagaagtgcttcagcgtcagcaacctgttctcgaggtttcttcacttgctcatgtaacttatcgaactcgtgaaggattgaatcga |
52800444 |
T |
 |
| Q |
101 |
acttctctgaatcaccgttcatcaaatcatctttttcctc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800445 |
acttctctgaatcaccgttcatcaaatcatctttttcctc |
52800484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 52800548 - 52800618
Alignment:
| Q |
140 |
cattgataagagacttgagtttgaagaactcggagcggatgattctgcaaatactggagtcctgatgctcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
52800548 |
cattgataagagacttgagtttgaagaactcggagcggatgattctgcgaatactggagtcctgattctcc |
52800618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 261 - 322
Target Start/End: Original strand, 52800651 - 52800712
Alignment:
| Q |
261 |
ggcggcggcgacgttgaggcgttctctcttaacgcgacgaaacagttgttgttcttcttctc |
322 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52800651 |
ggcggcggcggcgttgaggcgttctctcttaacgcgacgaaacacttgttgttcttcttctc |
52800712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 31849 - 31984
Alignment:
| Q |
1 |
gtgcgtgtcagatctagaaatgcttcagcgtcagcaacctgttctcgaggtttcttcacttgctcgtgtaacttatcgaactcatgaaggattgaatcga |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||| ||| ||| | || |||||||||||||||| |||||| ||||| ||||||||||||||||||| |
|
|
| T |
31849 |
gtgcgtgtcagatctagaagtgcttcagcgtcaacaatctgctcttgtggcttcttcacttgctcgtctaacttgtcgaagtcatgaaggattgaatcga |
31948 |
T |
 |
| Q |
101 |
acttctctgaatcaccgttcatcaaatcatcttttt |
136 |
Q |
| |
|
|||| || ||| || |||||| ||||||||||||| |
|
|
| T |
31949 |
acttgtccgaagcagtgttcattaaatcatcttttt |
31984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 32070 - 32140
Alignment:
| Q |
140 |
cattgataagagacttgagtttgaagaactcggagcggatgattctgcaaatactggagtcctgatgctcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
32070 |
cattgataagagacttgagtttgaagaactcggagcggatgattctgcgaatgttggagtcctgatgctcc |
32140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University