View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_high_24 (Length: 252)
Name: NF21435_high_24
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 50055190 - 50055332
Alignment:
| Q |
1 |
tggcttgtcaccattagtccagggacacttttggctatcccatgcaatgattactgcatcataatctagctgcaaagatatttttcttttccccttatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055190 |
tggcttgtcaccattagtccagggacacttctggctatcccatgcaatgattactgcatcataatctagctgcaaagatatttttcttttccccttatta |
50055289 |
T |
|
| Q |
101 |
taatcattattttcattttgttctccacacttctccttcacct |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055290 |
taatcattattttcattttgttctccacacttctccttcacct |
50055332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 137 - 238
Target Start/End: Complemental strand, 50054941 - 50054826
Alignment:
| Q |
137 |
ttcacctttgttagacctgctgttcactactttactagtcacctt--------------acattatattattcactggccacttttttctttctatcaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50054941 |
ttcacctttgttagacctgctgttcactactttactagtcacctttttacttttagcctagattatattattcactggccacttttttctttctatcaaa |
50054842 |
T |
|
| Q |
223 |
ttgtataaaggtgatg |
238 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
50054841 |
ctgtataaaggtgatg |
50054826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University