View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_high_29 (Length: 247)
Name: NF21435_high_29
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_high_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 42184885 - 42185124
Alignment:
| Q |
8 |
atgaatgctgcgggtgacgatgatagtaataaaatagcattatcaaattggctcaattcagcacaaccttggttaggttcaacacctggtggtccactag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184885 |
atgaatgctgcgggtgacgatgatagtactaaaatagcattatcaaattggctcaattcagcacaaccttggttaggttcaacacctggtggtccactag |
42184984 |
T |
 |
| Q |
108 |
ctgaagttctaaggccaagcaatgttacttccatcagtgatgcaacaaattctaatccatcttcacctctcacaacaacaaatcgtgtcgaatccattgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184985 |
ctgaagttctaaggccaagcaatgttacttccatcagtgatgcaacaaattctaatccatcttcacctctcacaacaacaaatcgtgtcgaatccattgg |
42185084 |
T |
 |
| Q |
208 |
cacttcaggaacaggaatggtatcctctccatctggtgtt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42185085 |
cacttcaggaacaggaatggtatcctctccatctggtgtt |
42185124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University