View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_high_35 (Length: 236)
Name: NF21435_high_35
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 130 - 221
Target Start/End: Complemental strand, 35146881 - 35146790
Alignment:
| Q |
130 |
gagtgcaaggatagaaattaaaattgttaacaaccaattataaaaccataacaatagcaaaagaggtaccaccaaatttaacgagttgtaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35146881 |
gagtgcaaggatagaaattaaaattgttaacaaccaattataaaaccataacaatagcaaaagaggtaccaccaaatttaacgagttgtaac |
35146790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 35147007 - 35146944
Alignment:
| Q |
1 |
ctaccatacacatgtaaaatcaacatgcacggttacggttggtcttttaatcaatagttttttt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35147007 |
ctaccatacacatgtaaaatcaacatgcacggttacggttggtcttttaatcaatagttttttt |
35146944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University