View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_high_37 (Length: 234)
Name: NF21435_high_37
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 14913548 - 14913767
Alignment:
| Q |
1 |
caacctcgttctcttcctcactcatcttcatctccatcatcaaccatagcaaaagcataatcacaaggttttacccttcataatcattaatttcagttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14913548 |
caacctcgttctcttcctcactcatcttcatctccatcatcaaccatagcaaaagcataatcacaaggttttacccttcataatcatcaatttcagttac |
14913647 |
T |
|
| Q |
101 |
ccttttgtctgttacttcttgatattgtagctgttatcaaatttttattcatcttggttttgttgtttgtgtggaatatctgttttggtcgatcttatgt |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14913648 |
ccttttgtttgttacttcttgatattgtagctgttatcaaatttttattcatcttggttttgttgtttgtgtggaatatgtgttttggtcgatcttatgt |
14913747 |
T |
|
| Q |
201 |
gtttttgcatgcaatttatg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14913748 |
gtttttgcatgcaatttatg |
14913767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University