View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_high_39 (Length: 229)
Name: NF21435_high_39
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 33375381 - 33375167
Alignment:
| Q |
1 |
tgaactgtgttgttttgaggttgttgtcatgtcttgatttaattgtttgagtaattgttagtatttgtgtgaaggtaatgaattagtcttttgagtgtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33375381 |
tgaactgtgttgttttgaggttgttgtcatgtcttgatttaattgtttgagtaattgttagtatttgtgtgaaggtaatgaattagttttttgagtgtgt |
33375282 |
T |
 |
| Q |
101 |
ggatcaaataggaaactttgcatatgaaattttgtggttggttgttattttccttccaaaatggcttgcattgtgtcaattgtgataatctttatgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33375281 |
ggatcaaataggaaactttgcatatgaaattttgtggttggttgttattttccttccaaaatggcttgcattgtgtcaattgtgataatctttatgatga |
33375182 |
T |
 |
| Q |
201 |
ttattgttaatgttg |
215 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
33375181 |
ttattcttaatgttg |
33375167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University