View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_14 (Length: 373)
Name: NF21435_low_14
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 31800039 - 31799738
Alignment:
| Q |
18 |
atttagagaactgaaagatttgcacgatgggaagaatatatatacatgtggacccgctttatttcatgtaatatttcgttaatccaatgtttaaaagctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31800039 |
atttagagaactgaaagatttgcacgatgggaagaatatatatacatgtggacccgctttatttcatgtaatatttcgttaatccaatgtttaaaagctt |
31799940 |
T |
 |
| Q |
118 |
ataaaaattgaatgattttaattacctctgatttaatttctacgggaaatagagagaattgatgttcacctatcttgtcatgcttactgtgtctgttgcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799939 |
ataaaaattgaatgattttaattacctctgatttaatttctacgggaaatagagagaattgatgttcacctatcttgtcatgcttactgtgtctgttgcg |
31799840 |
T |
 |
| Q |
218 |
caaagttcggctgtcaatcgagcaaagactaggcgcacgtatttgatgattgtttcaatcttttttctatttggtctcacgagttggaaaccaggtaacc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799839 |
caaagttcggctgtcaatcgagcaaagactaggcgcacgtatttgatgattgtttcaatcttttttctatttggtctcacgagttggaaaccaggtaacc |
31799740 |
T |
 |
| Q |
318 |
cc |
319 |
Q |
| |
|
|| |
|
|
| T |
31799739 |
cc |
31799738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University