View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_22 (Length: 252)
Name: NF21435_low_22
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 32874512 - 32874276
Alignment:
| Q |
1 |
tgttacattttagagatatgtgtctct--gtgtttgcataaacactatatatttggtcttgtgacgattcaagatttgctcgtcataaacactatatatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
32874512 |
tgttacattttagagatatgtgtctctttgtgtttgcataaacactatatatttggtcttgtgacgaatcaagatttgctcgacataaacattatatatt |
32874413 |
T |
 |
| Q |
99 |
tgatcttgtgacaattcaagacttgcttgtcaggaagagatgtgcaatttttgccaacaaagtataacggcgaaactcaaacatacaaagtgttgatgat |
198 |
Q |
| |
|
|| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32874412 |
tggtcttgtgacaattcaagacttgctcgtcatgaagagatgtgcaatttttgccaacaaagtataacaacgaaactcaaacatacaaagtgttgatgat |
32874313 |
T |
 |
| Q |
199 |
tgaagagttgcgtgtttgaacccatgtccatcatatt |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32874312 |
tgaagagttgcgtgtttgaacccttgtccatcatatt |
32874276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University