View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21435_low_23 (Length: 252)

Name: NF21435_low_23
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21435_low_23
NF21435_low_23
[»] chr7 (1 HSPs)
chr7 (10-252)||(32874680-32874922)


Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 32874922 - 32874680
Alignment:
10 atattattcttgatagatagatagatagataattcaactggacctcgtttggtgttggcagcatgtttatgcatacacctgcacttatagataaattttg 109  Q
    ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32874922 atattcttcttgatagatagatagatagataattcaaccggacctcgtttggtgttggcagcatgtttatgcatacacctgcacttatagataaattttg 32874823  T
110 ttcctttgtatctacttttgcttttgctttttgtcccatcaaaccatcaatattcaatagattcttcagtttgttctttgtgtgcgttgtcgaaccatga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32874822 ttcctttgtatctacttttgcttttgctttttgtcccatcaaaccgtcaatattcaatagattcttcagtttgttctttgtgtgcgttgtcgaaccatga 32874723  T
210 actctttgtttattagtacgatgttttgttttctaggatgaac 252  Q
    |||||||||||||||||||||||||||||||||||||||||||    
32874722 actctttgtttattagtacgatgttttgttttctaggatgaac 32874680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University