View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_23 (Length: 252)
Name: NF21435_low_23
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 32874922 - 32874680
Alignment:
| Q |
10 |
atattattcttgatagatagatagatagataattcaactggacctcgtttggtgttggcagcatgtttatgcatacacctgcacttatagataaattttg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874922 |
atattcttcttgatagatagatagatagataattcaaccggacctcgtttggtgttggcagcatgtttatgcatacacctgcacttatagataaattttg |
32874823 |
T |
 |
| Q |
110 |
ttcctttgtatctacttttgcttttgctttttgtcccatcaaaccatcaatattcaatagattcttcagtttgttctttgtgtgcgttgtcgaaccatga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874822 |
ttcctttgtatctacttttgcttttgctttttgtcccatcaaaccgtcaatattcaatagattcttcagtttgttctttgtgtgcgttgtcgaaccatga |
32874723 |
T |
 |
| Q |
210 |
actctttgtttattagtacgatgttttgttttctaggatgaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874722 |
actctttgtttattagtacgatgttttgttttctaggatgaac |
32874680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University