View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_25 (Length: 250)
Name: NF21435_low_25
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_25 |
 | |
|
| [»] scaffold0042 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 52800330 - 52800096
Alignment:
| Q |
1 |
ttaaatctcttgtcaacgaaggtgttactccttctcagtttgtttcatctcttctcaaacactatgctcacccacccaacaacac---ttccattgactg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
52800330 |
ttaaatctcttgtcaacgaaggtgttactccttctcagtttgtttcatctcttctcaaacactatgctcacccacccaacaacgccgcttccattgactg |
52800231 |
T |
|
| Q |
98 |
gcataaacttggcatttctgtttcccccattttcctcactgttcatggttcttctaccatgcttggtcccatggaaaatcagttgaaacaacgcaaaacc |
197 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800230 |
gcataaactcggcatttctgtttcccccattttcctcactgttcatggttcctctaccatgcttggtcccatggaaaatcagttgaaacaacgcaaaacc |
52800131 |
T |
|
| Q |
198 |
attgtttctagaaagagaaatcctcgctctactac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800130 |
attgtttctagaaagagaaatcctcgctctactac |
52800096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 31820 - 31652
Alignment:
| Q |
15 |
aacgaaggtgttactccttctcagtttgtttcatctcttctcaaacactatgctcacccacccaacaacacttccattgactggcataaacttggcattt |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
31820 |
aacgaaggggttactccttctcagtttgtgtcatctctcctcaaacattatgctcacccacccaaca---cttccattgactggcaaaagcttggcattt |
31724 |
T |
|
| Q |
115 |
ctgtttcccccattttcctcactgttcatggttcttctaccatgcttggtcccatggaaaatcagttgaaac |
186 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
31723 |
tcgtttcacccattttcctcactgttcatggctcttcaaccatgcttgatcccatggaaagtcagttgaaac |
31652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University