View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21435_low_31 (Length: 244)

Name: NF21435_low_31
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21435_low_31
NF21435_low_31
[»] chr7 (2 HSPs)
chr7 (15-92)||(42090758-42090835)
chr7 (159-200)||(42090902-42090943)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 42090758 - 42090835
Alignment:
15 tgtcttttagcaattcacacttcaaaaatgaaatttcttaaccaagatctcgaaggtatcggttaacaaactcaactt 92  Q
    ||||||||| |||| ||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||    
42090758 tgtcttttaacaatccacacttcaaaaacgaaatttctcaatcaagatctcgaaggtatcggttaacaaactcaactt 42090835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 42090902 - 42090943
Alignment:
159 tagatgccaaaaatgatttaaacattaataatagttctattt 200  Q
    |||||| |||||||||||||||||||||||||||||||||||    
42090902 tagatgacaaaaatgatttaaacattaataatagttctattt 42090943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University