View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_31 (Length: 244)
Name: NF21435_low_31
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 42090758 - 42090835
Alignment:
| Q |
15 |
tgtcttttagcaattcacacttcaaaaatgaaatttcttaaccaagatctcgaaggtatcggttaacaaactcaactt |
92 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42090758 |
tgtcttttaacaatccacacttcaaaaacgaaatttctcaatcaagatctcgaaggtatcggttaacaaactcaactt |
42090835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 42090902 - 42090943
Alignment:
| Q |
159 |
tagatgccaaaaatgatttaaacattaataatagttctattt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42090902 |
tagatgacaaaaatgatttaaacattaataatagttctattt |
42090943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University