View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_34 (Length: 237)
Name: NF21435_low_34
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 39597538 - 39597320
Alignment:
| Q |
1 |
cttcaatggcaaaatatggctgctggtgggtataatttttaatatatactgatgccatgtacttattggtaaattttcttcctttcacttggtgcatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39597538 |
cttcaatggcaaaatatggctgctggtgggtataatttttaatatatactgatgccatgtacttattggtaaattttcttcctttcacttggcgcatttt |
39597439 |
T |
|
| Q |
101 |
ggacagagacaaactataatcatgataaggggaaacgaaagattatttcataaatgagcnnnnnnnnngggaaggtggatgaaagatcattattgctatg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
39597438 |
ggacagagagaaactataatcatgataaggggaaacgaaagattatttcataaatgagcaaaaaaaaagggaaggtgaatgaaagatcattattgctatg |
39597339 |
T |
|
| Q |
201 |
acagtttgcgtggacttgc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39597338 |
acagtttgcgtggacttgc |
39597320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University