View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21435_low_39 (Length: 232)
Name: NF21435_low_39
Description: NF21435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21435_low_39 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 111 - 232
Target Start/End: Original strand, 55480680 - 55480801
Alignment:
| Q |
111 |
gactgtttcatttcaaaactagtatacctcaaccgcataaagaaataacccagctgttcaaataattctcttgctaaacagatttcacgtgaattggcac |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55480680 |
gactgtttcatttcaaaactggtatacctcaaccgcataaagaaataacccagctgttcaaataattctcttgctaaacagatttcacgtgaattggcac |
55480779 |
T |
 |
| Q |
211 |
aaataacccagctgttcttaat |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55480780 |
aaataacccagctgttcttaat |
55480801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 81
Target Start/End: Original strand, 55480640 - 55480669
Alignment:
| Q |
52 |
gatttatccaataattggcacaaataattc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55480640 |
gatttatccaataattggcacaaataattc |
55480669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University