View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21437_high_20 (Length: 274)
Name: NF21437_high_20
Description: NF21437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21437_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 40 - 253
Target Start/End: Complemental strand, 33866092 - 33865879
Alignment:
| Q |
40 |
tgaaagggatagtgatgaacttattactaataaaacgaatgtgctataaaagattctatccaatcaattctggtttcacgaatcggaaaaaacaaggaag |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33866092 |
tgaaagggatggtgatgaacttattactaataaaacgaatgtgctataaaagattctatccaatcaattctggtttcacgaatcggaaaaaacaaggaag |
33865993 |
T |
 |
| Q |
140 |
aatggtttcttagtaatggagaatatcttggattttgtatttatttatataatctttatttgacgaaatctttgatatttggatttaggacagctaactt |
239 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33865992 |
aatggtttcttaataattgagaatatcttggattttgtatttatttaaataatctttatttgacgaaatctttgatatttggattttggacagctaactt |
33865893 |
T |
 |
| Q |
240 |
agaatttcaccacc |
253 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33865892 |
agaatttcaccacc |
33865879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University