View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21437_low_21 (Length: 296)
Name: NF21437_low_21
Description: NF21437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21437_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 83 - 276
Target Start/End: Complemental strand, 30216591 - 30216398
Alignment:
| Q |
83 |
ggtaaaaagtgatttgtggcattgattaacattaactattaaaatcataataattaatgatttagctttattagtagtctgaaaagtgaaattagtgtca |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216591 |
ggtaaaaagtgatttgtggcattgattaacattaattataaaaatcataataattaatgatttagctttattagtagtctgaaaagtgaaattagtgtca |
30216492 |
T |
|
| Q |
183 |
ttaattattcgaaaacgacttaacaagctatcctcaactgttttgtctctctcataactcattcattcaacaactcaaatccagctctactagt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30216491 |
ttaattattcgaaaacgacttaacaagctatcctcaactgttttgtctctctcataactcattcattcaacaactcaaatccagctctactagt |
30216398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University