View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21437_low_25 (Length: 244)

Name: NF21437_low_25
Description: NF21437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21437_low_25
NF21437_low_25
[»] chr5 (1 HSPs)
chr5 (119-230)||(8728745-8728857)
[»] chr2 (1 HSPs)
chr2 (119-230)||(25507050-25507162)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 230
Target Start/End: Original strand, 8728745 - 8728857
Alignment:
119 tgaagtagtttagtgactagag-atttatctctttaaggtgaatacacaaggggttcaaaatcgcatcctaatttatttatacatacattataccgatca 217  Q
    |||||||||||||||| ||||| |||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |||||    
8728745 tgaagtagtttagtgattagaggatttatctctttaaggtgaataaacaaggtgtttaaaatcgcatcctaatttatttatacatacattatacagatca 8728844  T
218 attaagttaagtt 230  Q
    |||||||||||||    
8728845 attaagttaagtt 8728857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 230
Target Start/End: Complemental strand, 25507162 - 25507050
Alignment:
119 tgaagtagtttagtgactagag-atttatctctttaaggtgaatacacaaggggttcaaaatcgcatcctaatttatttatacatacattataccgatca 217  Q
    |||||||||||||||| ||||| |||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |||||    
25507162 tgaagtagtttagtgattagaggatttatctctttaaggtgaataaacaaggtgtttaaaatcgcatcctaatttatttatacatacattatacagatca 25507063  T
218 attaagttaagtt 230  Q
    |||||||||||||    
25507062 attaagttaagtt 25507050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University