View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21438_low_25 (Length: 265)
Name: NF21438_low_25
Description: NF21438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21438_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 19752894 - 19752731
Alignment:
| Q |
1 |
cttatttaaactctgtcgaatatgaatcaatcaaactcaaccttttaagctataactcagcaacaaattgaaattagaagaaactgaaaagtctctctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19752894 |
cttatttaaactctgtcgaatatgaatcaatcaaactcaaccttttaagctataactcagcaacaaattgaaattagaagaagctgaaaagtctctctag |
19752795 |
T |
|
| Q |
101 |
tcaaaacactggaaactaaattgggaactgaaaagttccttgaaataaataaatatcataaatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19752794 |
acaaaacactggaaactaaattgggaattgaaaagttccttgaaataaataaatatcataaatt |
19752731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 207
Target Start/End: Complemental strand, 19752711 - 19752669
Alignment:
| Q |
165 |
ttaaactttttaacttctcacatcctcaataaactgacccttt |
207 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19752711 |
ttaaaatttttaacttctaacctcctcaataaactgacccttt |
19752669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University