View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21438_low_27 (Length: 257)
Name: NF21438_low_27
Description: NF21438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21438_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 6314248 - 6314476
Alignment:
| Q |
23 |
aaaaactataacactcaaacaaataaattataactgtgtttatttttcatagggtgtttttgagaatggaagctacgcgaagagttcaagtggaaacgac |
122 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6314248 |
aaaaacgataacactcaaaaaaataaattacaactgtgtttatttttcatagggtgtttttgagaatggaagctacgcgaagagttcaagtggaaacgac |
6314347 |
T |
 |
| Q |
123 |
accgttttgaagcagaacttgcagaaagcgaggtttgatctgctacatgcagctgcaggagaagatgcaagggttcatcgagctaagtacgaagaagaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6314348 |
accgttttgaagcagaacttgcagaaagcgaggtttgatctgctacatgcagctgcaggagaagatgcaagggttcatcgagctaagtacgaagaagaag |
6314447 |
T |
 |
| Q |
223 |
aagctttttacggttttacccctaaaaac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6314448 |
aagctttttacggttttacccctaaaaac |
6314476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University