View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21438_low_30 (Length: 229)
Name: NF21438_low_30
Description: NF21438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21438_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 52605147 - 52604932
Alignment:
| Q |
1 |
ttgactcaaaaatttctaggtattatattcgatatctttnnnnnnnnnnnnagtttagattgtgaagatgaaattacaagaagtgatacttgtgatatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52605147 |
ttgactcaaaaatttctaggtattatattctatatcttttatata------agtttagattgtgaagatgaagttacaagaagtgatacttgtgatatgc |
52605054 |
T |
|
| Q |
101 |
attttgttttgggcttgtattgggtcaactacagtggcaaggaaaacagtttttgttggaaatttgtttgatggagcaaagaagaagaacagtagtagtg |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52605053 |
attttattttgggcttgtattgggtcaactacagtggcaaggaaaacagtttttgttggaaatttgtttgatggagcaaagaagaagaacagtagcagtg |
52604954 |
T |
|
| Q |
201 |
tggcagtacttgatgatgatgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52604953 |
tggcagtacttgatgatgatgt |
52604932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University