View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21438_low_8 (Length: 449)
Name: NF21438_low_8
Description: NF21438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21438_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 3e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 207 - 349
Target Start/End: Original strand, 35303065 - 35303205
Alignment:
| Q |
207 |
attcatggttggttaatgcaatgctttgtttttcagttccagtattttaaaatgcttctgttgtataattagagtgaatagcttagcttagttggccgat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||| || || |
|
|
| T |
35303065 |
attcatggttggttaatgcaatgctttgtttttcagttcaagtattttaaaatgcttctgttgtataattagagtgaatagtttagctcagttgtccaat |
35303164 |
T |
|
| Q |
307 |
gcataaaatatatgcaaaggtttgaggatcgaacctcgaccac |
349 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| |||| |||| |
|
|
| T |
35303165 |
gcataaa--atatgcaaagatttgaggatcgaaactcggccac |
35303205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University