View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21439_low_15 (Length: 237)
Name: NF21439_low_15
Description: NF21439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21439_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 2488957 - 2489193
Alignment:
| Q |
1 |
acaggttagaccggcaaattttgctgcatgaacaatctaacttttatatacttacttaattgtatttcgaaacagtttgtcccatgctctgggaatattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488957 |
acaggttagaccggcaaattttgctgcatgaacaatctaacttttatatacttacttaattgtatttcgaaacagtttgtcccatgctctgggaatattc |
2489056 |
T |
|
| Q |
101 |
caggcgggaaaattcagtgacagagattcattgaagttagaagctcaagcagtaacatctgaggtttgcagtgcttgtcgttattgtatttagttgtgaa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489057 |
caggcgggaaaattcggtgacagagattcattgaagttagaagctcaagcagtaacatctgaggtttgcagtgcttgtcgttattgtatttagttgtgaa |
2489156 |
T |
|
| Q |
201 |
taatatctaccaggtactgatataatctgtgtgtcct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489157 |
taatatctaccaggtactgatataatctgtgtgtcct |
2489193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University