View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2143_low_12 (Length: 231)
Name: NF2143_low_12
Description: NF2143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2143_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 22273661 - 22273461
Alignment:
| Q |
18 |
gaggatccagtcacataaggatacctaaaaatcaaaccaacatttaggtcaatttcaaaacaaa-tcgatgaacaaacaaaataaactatctcaattttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22273661 |
gaggatccagtcacataaggatacctaaaaatcaaaccaacatttaggtcaatttcaaaacaaaatcgatgaacaaacaaaataaactatctcaattttc |
22273562 |
T |
|
| Q |
117 |
gcgttgcacaaaaccttaaactgagtaaattgaaaaacacacacgccaacgaatgaattcactagagagagaaagaagggacatacaaggttctctgtga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22273561 |
gcgttgcacaaaaccttaaactgagtaaattgaaaaacacacacaccaacgaatgaattcactagagagagaaagaagggacatacaaggttctctgtga |
22273462 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
22273461 |
t |
22273461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University