View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_high_33 (Length: 348)
Name: NF21440_high_33
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 17 - 334
Target Start/End: Complemental strand, 3689153 - 3688836
Alignment:
| Q |
17 |
atttcacatctatcatttcacttcatgttgccaagaatagattacccaacagaagcagacaatcatagtcttcttccatatcaagtatcacaaaatcctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3689153 |
atttcacatctatcatttcacttcatgttgccaagaatagattacccaacagaagcagacaatcatagtcttcttccatatcaagtatcacaaaatccac |
3689054 |
T |
|
| Q |
117 |
aagaaaaatgaacttgtcaacctccaaaagtatctcttccaccatgccatatggatattagacgaatatgtctgccagtgtgagggtcatcttagcaggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3689053 |
aagaaaaatgaacttgtcaacctccaaaagtatctcttccaccatgccatatggatattagacgaatatgtctgccagtgtgagggtcatcttagcaggt |
3688954 |
T |
|
| Q |
217 |
ttaaccttcaccacttcgagtttcttcaacatggagagtgatatcagattgatgctttctttcatatcgagaattttcccataatgcaatgaataattaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3688953 |
ttaaccttcaccacttcgagtttcttcaacatggagagtggtatcagattgatgctttctttcatatcgagaattttcccataatgcaatgaataattaa |
3688854 |
T |
|
| Q |
317 |
actagttgggtctttttt |
334 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3688853 |
actagttgggtctttttt |
3688836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University