View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_high_34 (Length: 345)
Name: NF21440_high_34
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 39780237 - 39780477
Alignment:
| Q |
14 |
agacagaaagaaagtttgcagcatgatggatttccagaagctatcgcgagaggcgcgaacacatgctgcacaaaacaacaggcttcctgcccaaaatgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39780237 |
agacagaaagaaagtttgcagcatgatggatttccagaagctatcgcgagaggcgcgaacacatgctgcacaaaacaacaggcttcctgcccaaaatgtg |
39780336 |
T |
 |
| Q |
114 |
gctcaaattctctattatgaacagcaacgtcttcgcgacaacatggatggcactggcagcttaggttcagattcgccttcaacgcctgacaagaggaatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39780337 |
gctcaaattctctattatgaacagcaacgtcttcgcgacaacatggatggcactggcagcgtaggttcagattcgccttcaacgcctgacaagaggaatg |
39780436 |
T |
 |
| Q |
214 |
tatactcatctgagctttatccggctactaatgaggtttcc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39780437 |
tatactcatctgagctttatccggctactaatgaggtttcc |
39780477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University