View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_high_37 (Length: 339)
Name: NF21440_high_37
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 17 - 328
Target Start/End: Complemental strand, 41535686 - 41535380
Alignment:
| Q |
17 |
acacacttacgtgtaaaaataattgtttacgcacccctccaagtaatttaatcaagccacactcgtctatttgtatgtttggattggtgtcgtatttaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41535686 |
acacacttacgtgtaaaaataattgtttacgcacccctccaagtaatttaatcaagccacactcgtctatttgtatgtttggattggcgtcgtatttaga |
41535587 |
T |
|
| Q |
117 |
caaaatcgtgttgaaaaccatggcaacacagaagcttgatatactagctttagaatttccacaaccaccatgctttgcgaagcggtattggtttggcaaa |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41535586 |
caaaatcgcgttgaaaaccatggcaacacagaagcttgatatactagcttcagaatttccacaaccaccatgctttgcgaagcggtattggtttggcaaa |
41535487 |
T |
|
| Q |
217 |
cacttatccaacggaggtttaagcaatgcgagtttcgagagtttagtttagactctttgctctccgctgaaagacaaagttactgaggtcatggtcaaca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41535486 |
cacttatccaacggaggtttaagcaatgccagtttcgagagt-----ttagactctttgctctccgctgaaagacaaagttaccgaggtcatggtcaaca |
41535392 |
T |
|
| Q |
317 |
gatcgtcatccc |
328 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41535391 |
gatcgtcatccc |
41535380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 26135483 - 26135617
Alignment:
| Q |
93 |
gtttggattggtgtcgtatttagacaaaatcgtgttgaaaaccatggcaacacagaagcttgatatactagctttagaatttccacaaccaccatgcttt |
192 |
Q |
| |
|
|||||||||||||||||||| |||||||| | ||||||||||| ||||| |||||||||||||||||||||| |||||| ||| | ||| ||| || |
|
|
| T |
26135483 |
gtttggattggtgtcgtattaggacaaaatggcgttgaaaaccacggcaatgcagaagcttgatatactagcttctgaattttcacggcaaccgtgcatt |
26135582 |
T |
|
| Q |
193 |
gcgaagcggtattggtttggcaaacacttatccaa |
227 |
Q |
| |
|
| || |||||||| | ||||||||| ||||||||| |
|
|
| T |
26135583 |
gggacgcggtattagattggcaaacgcttatccaa |
26135617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 174
Target Start/End: Complemental strand, 26937714 - 26937629
Alignment:
| Q |
89 |
gtatgtttggattggtgtcgtatttagacaaaatcgtgttgaaaaccatggcaacacagaagcttgatatactagctttagaattt |
174 |
Q |
| |
|
||||||||||| ||| |||||||| ||| |||||| | |||||| || |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26937714 |
gtatgtttggaatggcatcgtatttggactaaatcgcggtgaaaaacacggcaacacagaagcttgacatactagcttcagaattt |
26937629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 87 - 164
Target Start/End: Complemental strand, 38170106 - 38170029
Alignment:
| Q |
87 |
ttgtatgtttggattggtgtcgtatttagacaaaatcgtgttgaaaaccatggcaacacagaagcttgatatactagc |
164 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||| | ||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
38170106 |
ttgtatgtttggattggcgtcgtatttggataaaattgcattggaaaccatgacaacacagaagcttgatatattagc |
38170029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 89 - 173
Target Start/End: Original strand, 20791015 - 20791099
Alignment:
| Q |
89 |
gtatgtttggattggtgtcgtatttagacaaaatcgtgttgaaaaccatggcaacacagaagcttgatatactagctttagaatt |
173 |
Q |
| |
|
||||||||||| ||| || |||| |||||||||| ||||||||| | |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
20791015 |
gtatgtttggaatggcatcagatttggacaaaatcgcgttgaaaacgacggcaacccagaagcttgatatactagcttcagaatt |
20791099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University