View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21440_high_58 (Length: 256)

Name: NF21440_high_58
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21440_high_58
NF21440_high_58
[»] chr8 (1 HSPs)
chr8 (21-89)||(41433657-41433725)
[»] chr2 (1 HSPs)
chr2 (51-81)||(35381792-35381822)
[»] chr4 (1 HSPs)
chr4 (53-81)||(16467473-16467501)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 89
Target Start/End: Original strand, 41433657 - 41433725
Alignment:
21 gaaaacaataatctgaagacatttcattacaaaagagttttagcaaataaataatcgaatatcaatata 89  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
41433657 gaaaacaataatctgaagacatttcattagaaaagagttttagcaaataaataatcgaatatcaatata 41433725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 81
Target Start/End: Original strand, 35381792 - 35381822
Alignment:
51 aaaagagttttagcaaataaataatcgaata 81  Q
    |||||||||||||||||||||||||||||||    
35381792 aaaagagttttagcaaataaataatcgaata 35381822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 81
Target Start/End: Complemental strand, 16467501 - 16467473
Alignment:
53 aagagttttagcaaataaataatcgaata 81  Q
    |||||||||||||||||||||||||||||    
16467501 aagagttttagcaaataaataatcgaata 16467473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University