View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21440_high_68 (Length: 234)

Name: NF21440_high_68
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21440_high_68
NF21440_high_68
[»] chr2 (1 HSPs)
chr2 (1-103)||(35456151-35456252)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 35456151 - 35456252
Alignment:
1 ctaattttgctactgtgcattaaccgatttccttggcatgcactcattttaaaagtaacttaattattcacaataaatattcgtccgtgctatacttggc 100  Q
    |||| ||||| ||||| ||||||||||||| ||||||||| ||  ||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||    
35456151 ctaactttgccactgtacattaaccgatttacttggcatgaaccaattttaatagtaacttaattactcac-ataaatattcgtccgtgctatacttggc 35456249  T
101 ttg 103  Q
    |||    
35456250 ttg 35456252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University