View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21440_high_7 (Length: 482)

Name: NF21440_high_7
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21440_high_7
NF21440_high_7
[»] chr2 (5 HSPs)
chr2 (290-405)||(9833729-9833844)
chr2 (295-383)||(2264024-2264112)
chr2 (148-192)||(9833587-9833631)
chr2 (19-60)||(9833458-9833499)
chr2 (440-471)||(9833867-9833898)
[»] chr4 (3 HSPs)
chr4 (295-383)||(38245381-38245469)
chr4 (298-383)||(26577713-26577798)
chr4 (295-383)||(10472970-10473058)
[»] chr1 (4 HSPs)
chr1 (295-383)||(23175043-23175131)
chr1 (295-383)||(11422069-11422157)
chr1 (295-383)||(34370124-34370212)
chr1 (295-383)||(4097462-4097550)
[»] chr3 (4 HSPs)
chr3 (148-189)||(51681948-51681989)
chr3 (327-367)||(51681636-51681676)
chr3 (326-364)||(47728779-47728817)
chr3 (151-187)||(47728470-47728506)


Alignment Details
Target: chr2 (Bit Score: 116; Significance: 8e-59; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 290 - 405
Target Start/End: Original strand, 9833729 - 9833844
Alignment:
Q  290 gccgagctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtggtttgg 389  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9833729 gccgagctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtggtttgg 9833828  T
Q  390 ttccatatctattgag 405  Q
    ||||||||||||||||    
T  9833829 ttccatatctattgag 9833844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 295 - 383
Target Start/End: Original strand, 2264024 - 2264112
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    |||||||||||||||| |||||||| ||| ||||||||||||||||||| |||||| |||||| ||||||||||||||||| |||||||    
T  2264024 gctagcttcttcttcgtgttcttggggagttctgaagtgggttgtgatgattctgggtttggaggtggaactgtggattcgggttcgtg 2264112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 148 - 192
Target Start/End: Original strand, 9833587 - 9833631
Alignment:
Q  148 gcttcaatcaccttcactctctcttcctctgttatccccgctata 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  9833587 gcttcaatcaccttcactctctcttcctctgttatccccgctata 9833631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 9833458 - 9833499
Alignment:
Q  19 ataagatgagagaattcaacatcaacaataacattctgccct 60  Q
    |||||||||||||||||||||||||||| |||||||||||||    
T  9833458 ataagatgagagaattcaacatcaacaacaacattctgccct 9833499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 440 - 471
Target Start/End: Original strand, 9833867 - 9833898
Alignment:
Q  440 ttgaagatttgttttacaccctaactccctat 471  Q
    ||||||||||||||||||||||||||||||||    
T  9833867 ttgaagatttgttttacaccctaactccctat 9833898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 5e-26; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 295 - 383
Target Start/End: Original strand, 38245381 - 38245469
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    ||||||| |||||||| |||||||| ||| |||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||    
T  38245381 gctagctacttcttcgtgttcttggggagttctgaagtgggttgtgatggttctgggtttggaggtggaactgtggattcgggttcgtg 38245469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 298 - 383
Target Start/End: Complemental strand, 26577798 - 26577713
Alignment:
Q  298 agcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    ||||||||||||| |||||||| ||| |||||||||||||| ||||||||||| |||||| ||||||||||||||||| |||||||    
T  26577798 agcttcttcttcgtgttcttggggagttctgaagtgggttgcgatggttctgggtttggaggtggaactgtggattcgggttcgtg 26577713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 295 - 383
Target Start/End: Original strand, 10472970 - 10473058
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    |||||||| ||||||| |||||||| ||| | |||||||||||||||||||||| | |||||| ||||||||||||||||| |||||||    
T  10472970 gctagctttttcttcgtgttcttggggagttttgaagtgggttgtgatggttctaggtttggaggtggaactgtggattcgggttcgtg 10473058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 61; Significance: 5e-26; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 295 - 383
Target Start/End: Complemental strand, 23175131 - 23175043
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    |||||||||||||||| |||| ||| ||| |||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||    
T  23175131 gctagcttcttcttcgtgttcctggggagttctgaagtgggttgtgatggttctgggtttggaggtggaactgtggattcgggttcgtg 23175043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 295 - 383
Target Start/End: Original strand, 11422069 - 11422157
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    |||||||||||||||| |||||||| ||  |||||||||||||||||||||||||  |||||| ||||||||||||||||| |||||||    
T  11422069 gctagcttcttcttcgtgttcttggggatttctgaagtgggttgtgatggttctgtgtttggaggtggaactgtggattcgggttcgtg 11422157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 295 - 383
Target Start/End: Original strand, 34370124 - 34370212
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    |||||||||||||||| ||||||||  || |||||||||||||||||||||||||  |||||| ||||||||||||||||  |||||||    
T  34370124 gctagcttcttcttcgtgttcttgggaagttctgaagtgggttgtgatggttctgtgtttggaggtggaactgtggattcaggttcgtg 34370212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 295 - 383
Target Start/End: Complemental strand, 4097550 - 4097462
Alignment:
Q  295 gctagcttcttcttcgcgttcttggagagctctgaagtgggttgtgatggttctggctttggaagtggaactgtggattcgcgttcgtg 383  Q
    |||||||||||||||| |||||| | ||| |||||||||||||||||||||| ||| |||||| |||||||| || ||||| |||||||    
T  4097550 gctagcttcttcttcgtgttctttgggagttctgaagtgggttgtgatggttttgggtttggaggtggaactatgaattcgggttcgtg 4097462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 51681989 - 51681948
Alignment:
Q  148 gcttcaatcaccttcactctctcttcctctgttatccccgct 189  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  51681989 gcttcaatcaccttcactctctcttcctccgttatccccgct 51681948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 327 - 367
Target Start/End: Complemental strand, 51681676 - 51681636
Alignment:
Q  327 tgaagtgggttgtgatggttctggctttggaagtggaactg 367  Q
    |||||||||||||||||||||||| |||||| |||||||||    
T  51681676 tgaagtgggttgtgatggttctgggtttggaggtggaactg 51681636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 364
Target Start/End: Original strand, 47728779 - 47728817
Alignment:
Q  326 ctgaagtgggttgtgatggttctggctttggaagtggaa 364  Q
    ||||||||||||||||||||||||| |||||| ||||||    
T  47728779 ctgaagtgggttgtgatggttctgggtttggaggtggaa 47728817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 151 - 187
Target Start/End: Original strand, 47728470 - 47728506
Alignment:
Q  151 tcaatcaccttcactctctcttcctctgttatccccg 187  Q
    |||||||||||||||||||||||||| ||||| ||||    
T  47728470 tcaatcaccttcactctctcttcctccgttattcccg 47728506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University