View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_high_75 (Length: 222)
Name: NF21440_high_75
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_high_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 56231921 - 56232110
Alignment:
| Q |
17 |
cacagattacttatgcagatggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttctcatcccttcatttgtata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56231921 |
cacagattacttatgcagatggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttctcatcccttcatttgtata |
56232020 |
T |
|
| Q |
117 |
gttggtcttcatagataattcaattatttcaacattgttctcttaacaccttacctttaatcaatgtcgttattatcacataacaggaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56232021 |
gttggtcttcatagataattcaattatttcaacattgttctcttaacaccttacctttaatcaatgtcgttattatcacataacaggaat |
56232110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 39189715 - 39189900
Alignment:
| Q |
17 |
cacagattacttatgcagatggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttctcatcccttcatttgtata |
116 |
Q |
| |
|
|||| |||| ||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39189715 |
cacatattatttatgaagatggtgttgctgtctttgcctacatcaattcaaccaagtaacttttgttgctc-ctccttttgtcatcccttcatttgctcc |
39189813 |
T |
|
| Q |
117 |
gt--tggtcttcatagataattcaattatttcaacattgttctcttaacaccttacctttaatcaatgtcgttattatcacataacaggaat |
206 |
Q |
| |
|
| | ||||||||||||||||||||| |||||||||||||||||||| ||| ||||| |||||||||||||||| |||| |||||| |
|
|
| T |
39189814 |
ctccttttcttcatagataattcaattaattcaacattgttctcttaac-----accgttaattaatgtcgttattatcatataataggaat |
39189900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 59
Target Start/End: Complemental strand, 43014409 - 43014361
Alignment:
| Q |
11 |
cagcatcacagattacttatgcagatggcgttgctctctttgcctacat |
59 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||| | ||||||||||| |
|
|
| T |
43014409 |
cagcatcacagattaattatgaagatggtgttgctgtgtttgcctacat |
43014361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University