View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_43 (Length: 328)
Name: NF21440_low_43
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 101 - 317
Target Start/End: Complemental strand, 41984362 - 41984146
Alignment:
| Q |
101 |
acaaatatctgtaatgggatctgcatgatcagttcatcatctatagtttttaacaaggccttcactaatgttgatttcactattctgtacttagtaagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984362 |
acaaatatctgtaatgggatctgcatgatcagttcatcatctatagtttttaacaaggccttcactaatgttgatttcactattctgtacttagtaagga |
41984263 |
T |
|
| Q |
201 |
tagcaaattaaaaaacaatttctcccaacatgaccaattatttcttcatgttactggactgnnnnnnncctaattcacaaatgctgtattaatcacccta |
300 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41984262 |
tagcaaattaaaaaacactttctcccaacatgaccaattatttcttcatgttactggactgtttttttcctaattcacaaatgctgtattaatcacccta |
41984163 |
T |
|
| Q |
301 |
accatatatgtgcctat |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41984162 |
accatatatgtgcctat |
41984146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 41984409 - 41984367
Alignment:
| Q |
18 |
cagcttctacttaatattatcagtctccatttcacctcattgc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984409 |
cagcttctacttaatattatcagtctccatttcacctcattgc |
41984367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University