View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_44 (Length: 328)
Name: NF21440_low_44
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 315
Target Start/End: Complemental strand, 45378665 - 45378367
Alignment:
| Q |
14 |
atcatgaaacaaactaaataagatgacatattatttattatctggacggtgctaaactaaatatgacacgtccaaggcagaatccaataccaactcttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378665 |
atcatgaaacaaactaaataagatgacatattatttatcatctggacggtgctaaactaaatatgacacgtccaaggcagaatccaataccaactcttct |
45378566 |
T |
|
| Q |
114 |
ctttccacgtgtccctcgattcatttcatcacaaacattatttattattaattgtatatgagagagggaccattcctattgtttagaaagaattccactt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45378565 |
ctttccacgtgtccctcgattcatttcatcagaaacattatttatta---attgtatatgagagagggaccattcctattgtttagaaagaattgcactt |
45378469 |
T |
|
| Q |
214 |
gcatacgccaaatacctaggtagtttgaacctcaacaaactttactcgtttaaccgttttctcagttatcttcatcttaaatcaaatcgtctctgcttct |
313 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378468 |
gcatacgccaaatacctatgtagtttgaacctgaacaaactttactcgtttaaccgttttctcagttatcttcatcttaaatcaaatcgtctctgcttct |
45378369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University