View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_50 (Length: 305)
Name: NF21440_low_50
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 4 - 287
Target Start/End: Complemental strand, 51021426 - 51021143
Alignment:
| Q |
4 |
atgtccaagaatatgtcattgtgtacagagcctaccagttgggtgttcccacaaacacggccaccggaggagtctcacggatagtcacacacatatgtct |
103 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51021426 |
atgtccaaggaaatgtcattgtgtacagagcctaccaattgggtgttcccacaaacacggccaccggaggagtctcacggatagtcacacacatatgtct |
51021327 |
T |
 |
| Q |
104 |
ccaaagcttttcttgtcggcatgtgaggtccagagtacctttatgtggtctactcattgtaccgctggttacctttggtccaaagtacttcctggttatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51021326 |
ccaaagcttttcttgtcggcatgtgaggtccagagtacctttatgtggtctactcattgtatcgctggttacctttggtccaaagtacttcctggttatg |
51021227 |
T |
 |
| Q |
204 |
ttgagagtaagaccacttttagcttgtgggtctcacattcaaattgatttttccaccgttttcattgagctgttgtggcccctc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51021226 |
ttgagagtaagaccacttttagcttgtgggtctcacattcaaattgatttttccaccgttttcattgagctgttgtggcccctc |
51021143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University