View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_52 (Length: 296)
Name: NF21440_low_52
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 21 - 283
Target Start/End: Original strand, 41876729 - 41876994
Alignment:
| Q |
21 |
ggaatagtaatttcaggtggcaatgttgatatggcagtgctttggaattatttgaacaaatcaaaatgacttttcgttattattcaattactgatgtaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41876729 |
ggaatagtaatttcaggtggcaatgttgatatggcagtgctttggaattatttgaacaaatcaaaatgacttttcgttattattcaattactgatgtaaa |
41876828 |
T |
 |
| Q |
121 |
agtttgtgtggat---tatctcaatgctactagcatttattaatatgaaataaaaagtatttgaattaatccaaaatttataaaacttgagtattttaca |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||| | |||||||| ||||||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
41876829 |
agtttgtgtggattaatatctcaatgctactagcatttactaatttaaaataaaatatatttgaattaattcgaaatttatacaacttgagtattttaca |
41876928 |
T |
 |
| Q |
218 |
tacaatttatttgaatttataaataacattttattgtaatttaaacggtaccaaacggcacaggtt |
283 |
Q |
| |
|
||| ||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41876929 |
taccatttatttgaatttacaaataatattttattgtaatttaaacggcaccaaacggcacaggtt |
41876994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 40867316 - 40867242
Alignment:
| Q |
21 |
ggaatagtaatttcaggtggcaatgttgatatggcagtgctttggaattatttgaacaaatcaaaatgacttttc |
95 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||| ||||||||| ||| | ||||||||| ||| ||||||||| |
|
|
| T |
40867316 |
ggaatagtagtgtcaggtggaaatgttgatatggccgtgctttgggattctctgaacaaatgaaattgacttttc |
40867242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University