View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_61 (Length: 254)
Name: NF21440_low_61
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_61 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 39 - 235
Target Start/End: Complemental strand, 21699802 - 21699609
Alignment:
| Q |
39 |
aagaacataatggagggatggttagctgtgcatatactccccccactgatacaaaactacatcatggtccggctataggtaaccccacgcatctctaatc |
138 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
21699802 |
aagaacataatggagggatgggtagcagtgcata--ctccccccactgatacaaaaccacatcatggtccgactataggtaaccccacgcgccactaatc |
21699705 |
T |
|
| Q |
139 |
agctgaatcgatcagatggcagaagcccgcaccgggacgactgaaatgcaacattgacgcctctttttcttctcgatggaatcgcacaggtattgga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
21699704 |
agctgaatcgatcagatggcagaagcccgcaccgggacgactgaaatgcaacattgacgcctctttttctt-ttgatggaatcgcataggtattgga |
21699609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 235
Target Start/End: Complemental strand, 191456 - 191403
Alignment:
| Q |
182 |
aaatgcaacattgacgcctctttttcttctcgatggaatcgcacaggtattgga |
235 |
Q |
| |
|
||||||||||||||||| ||||||| |||| || |||||||||||||||||| |
|
|
| T |
191456 |
aaatgcaacattgacgcgactttttcctctcaattcaatcgcacaggtattgga |
191403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 44885983 - 44886036
Alignment:
| Q |
182 |
aaatgcaacattgacgcctctttttcttctcgatggaatcgcacaggtattgga |
235 |
Q |
| |
|
||||||||||||||||| ||||||| |||| || |||||||||||||||||| |
|
|
| T |
44885983 |
aaatgcaacattgacgcggctttttcctctcaattcaatcgcacaggtattgga |
44886036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University