View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_67 (Length: 238)
Name: NF21440_low_67
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_67 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 25948120 - 25947901
Alignment:
| Q |
19 |
tctgccccgctgacacccctagagacaacatactcccttgttttaaagctcgtgaaggaaaaatagaacctaaaaagatcaatattaatcaacataaagt |
118 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25948120 |
tctgccccattgacacccctagaaacaacatactcccttgttttaaagctcgtgaaggaaaaatagaacctaaaaagatcaatattaatcaacataaagt |
25948021 |
T |
 |
| Q |
119 |
aattaacagtggcgacacgcaaaagcatccaatcacccgatctagaggcaaaccctaatttttgcaacatagttacatacctgaatacaagccatagaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | | | |
|
|
| T |
25948020 |
aattaacagtggcgacacgcaaaagcatccaatcacccgatctagaggcaaaccctaatttttgcaacatagttacatacctgattacaagccacataca |
25947921 |
T |
 |
| Q |
219 |
agatctcagaaccacatagc |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25947920 |
agatctcagaaccacatagc |
25947901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University