View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_68 (Length: 238)
Name: NF21440_low_68
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 38341387 - 38341604
Alignment:
| Q |
5 |
gagaagcataggaatctattattacagaacaaaagtacttgaaagcacgtgatactagacatcgaaatagtaagttgttctcacttactagtgatggaat |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38341387 |
gagaagcattggaatctattattacagaacaaaagtacttgaaagcacgtgatactagacatcgaaatagtaagttgttctcacttactagtgatggaat |
38341486 |
T |
 |
| Q |
105 |
tcatgtgtacatttatcaaactcatgcatcttgataga-ggagtatgtatatgataaatttcttttgtaactgtagcaaacgagagcaccagaaaacgtg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38341487 |
tcatgtgtacatttatcaaactcatgcatcttgatagatagagga-gtatatgataaatttcttttgtaactgtagcaaacgagagcaccagaaaacgtg |
38341585 |
T |
 |
| Q |
204 |
ttatcttttacacactctt |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38341586 |
ttatcttttacacactctt |
38341604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University