View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_69 (Length: 235)
Name: NF21440_low_69
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 2614523 - 2614301
Alignment:
| Q |
1 |
aagttttgtagttgtttgtaggtacatgggttgggggttaggcaattggggataattgtagnnnnnnnn---attgattgtgttttaaaggtgaaagctt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2614523 |
aagttttgtagttgtttgtaggtacatgggttgggggttaggcaattggggataattgtagtttttttttttattgattgtgttttaaaggtgaaagctt |
2614424 |
T |
 |
| Q |
98 |
tgtttcaatttggaaattggaatggacatagattcttatgtattgtatagtt--tgtaataatctatgatttatagaaaaagtgtcacaaatatcttgtt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2614423 |
tgtttcaatttggaaattggaatggacatagattcttatgtattgtatagtttgtgtaataatctatgatttatagaaaaagtgtcacaaatatcttgtt |
2614324 |
T |
 |
| Q |
196 |
tagcatggttcgaatatgactca |
218 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2614323 |
tagcatggttcgaatatgactca |
2614301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University