View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_70 (Length: 234)
Name: NF21440_low_70
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 35456151 - 35456252
Alignment:
| Q |
1 |
ctaattttgctactgtgcattaaccgatttccttggcatgcactcattttaaaagtaacttaattattcacaataaatattcgtccgtgctatacttggc |
100 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||| ||||||||| || ||||||| ||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
35456151 |
ctaactttgccactgtacattaaccgatttacttggcatgaaccaattttaatagtaacttaattactcac-ataaatattcgtccgtgctatacttggc |
35456249 |
T |
 |
| Q |
101 |
ttg |
103 |
Q |
| |
|
||| |
|
|
| T |
35456250 |
ttg |
35456252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University