View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_75 (Length: 226)
Name: NF21440_low_75
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_75 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 82 - 226
Target Start/End: Original strand, 25947704 - 25947848
Alignment:
| Q |
82 |
ttgaaatccagagtcaaattcttcaaatatgttcaaagatttagacaagattagtgaataaattacaattaagaaacaccaaaagagtttaatttcatat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947704 |
ttgaaatccagagtcaaattcttcaaatatgttcaaagatttagacaagattagtgaataaattacaattaagaaacaccaaaagagtttaatttcatat |
25947803 |
T |
|
| Q |
182 |
gatgactgaataaatccatcaaataatgagaattaattgttcatt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947804 |
gatgattgaataaatccatcaaataatgagaattaattgttcatt |
25947848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 25947618 - 25947649
Alignment:
| Q |
1 |
attgtctacagttttgggtatagtaatggatt |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25947618 |
attgtctacagttttgggtatagtaatggatt |
25947649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University