View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_76 (Length: 225)
Name: NF21440_low_76
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 29698762 - 29698933
Alignment:
| Q |
18 |
aatggggtcaaagctttttatctcaaaatgtcaatcaaccgtccttctcttacacatttttcagcgcatttacattggctaaccattacaatttacatgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
29698762 |
aatggggtcaaagctttttatctcaaaatgtcaatcaaccgtccttctcttacacatttttcagcgcatttgcatttgctaacca-------ttacatgt |
29698854 |
T |
|
| Q |
118 |
atctttgttaatttgtttgtactttatgtatgacatgactagaataggtcttctttattttaggttaggatagttgtta |
196 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29698855 |
gtcttttttaatttgtttgtactttatgtatgacatgactagaataggtcttgtttattttaggttaggatagttgtta |
29698933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University